Detection of Variation in Expression of Insecticide Resistance Gene Cyp4d2 involved in Detoxification of Insecticides in Drosophila melanogaster

 

Preety Sweta Hembrom, Jisna Jose, Shalini K, Tony Grace*

Department of Genomic Science, School of Biological Sciences, Central University of Kerala, Padanakkad, Kasaragod, Kerala, India

*Corresponding Author E-mail: tonygrace99@gmail.com

 

ABSTRACT:

Insecticides which are used to control insects by killing them or restricting them from executing destructive behaviors are one of the major factors for improving the agricultural yield and preventing crop destruction. However, widespread and overuse of chemical insecticides has led to many harmful effects on the environment as well as on mankind. Frequent use of the same group of chemical insecticides has resulted in the evolution of insecticide resistance. Insecticide resistance develops by the selection of genes that provide tolerance to these chemicals. The present study aims to determine if CYP4d2 gene has any role in endosulfan detoxification. The expression analysis of CYP4d2 gene using Real Time PCR revealed that CYP4d2 exhibited a significant upregulation in the Periya sample, whereas downregulation in the Muliyar sample. Higher expression of CYP4d2 gene was observed in the endosulfan-treated adult stage when compared to the endosulfan-treated larval stage.

 

KEYWORDS: CYP4d2, Cytochrome p450, Detoxification, Endosulfan, Gene Expression, Insecticides, RT-PCR.

 

 

 

INTRODUCTION:

Agriculture sector, which forms the chief source of national income of India, is adversely affected by pests and diseases. Pests that destroy crops and affect the yield and quality, include microbes, insects, snails, slugs, birds, rodents, weeds, vertebrates etc.¹ Pesticides are substances used to destroy, suppress or alter the life cycle of pests. Insecticides are one of the major pesticides, commonly used to control the insects either by killing them or by inhibiting their destructive behavior thereby preventing crop destruction.² Even though pesticides can improve the quality and yield of crops by controlling pests, the overuse of chemical pesticides is associated with so many dangerous effects to man and his environment.³ Pesticides can even disrupt the balance of the ecosystem by killing non-pest organisms also. With each level of the food chains, these chemicals are found to show an increase in the concentration due to biomagnifications or bioaccumulation. 

 

The repeated use of the same class of pesticides or insecticides has resulted in the development of resistance.4

 

Exploring the molecular mechanisms underlying insecticide resistance is significant for maintaining insecticide efficiency, developing new insecticides and implementing extensive insecticide resistance management strategies.5 Metabolic detoxification is one of the most prevalent insecticide resistant mechanisms. Enzymes encoded by members of different gene families such as glutathione s transferases; Cytochrome P450 and esterase are involved in metabolic detoxification.6 The emergence of metabolic resistance can be the consequence of increased activities of one or more detoxifying enzyme capable of insecticide biodegradation, and the augmentation in their activity may be due to various mechanisms such as over expression, amplification, and point mutations in coding sequences.7

 

Drosophila melanogaster, a model insect has been used as a key tool in validating the role of enzymes in mediating metabolism-based insecticide resistance. Among insects, the Drosophila genome sequence provided the first comprehensive report of cytochrome P450 variety with approximately 85 active CYP genes.8 Many cytochrome P450 genes and a glutathione s transferase gene that confer metabolism based insecticide resistance have been identified in different populations of Drosophila melanogaster.9 Through microarray analysis of all P450s in Drosophila melanogaster, it is shown that a gene conferring resistance to DDT, known as DDT-R gene is associated with over transcription of a single cytochrome P450 gene, Cyp6g1.10 Higher expression of Cyp6g1 gene results in insecticide resistance to different classes such as DDT, neonicotinoids, and lufenuron.11 Studies done on detoxification in Drosophila melanogaster have already established the P450 expression patterns in the embryos and 2 stages of third instar larvae.12

 

Endosulphan, both effective and economical organochlorine insecticide was used in agriculture, especially in cashew plantation to increase productivity. It is considered as one of the most toxic pesticides responsible for many critical pesticide poisoning incidents around the world.13 Endosulfan is highly persistent in the global atmosphere compared to different other organochlorines.¹4 The endosulfan tragedy reported in Kasaragod district of Kerala is considered as one of the world’s worst pesticide disasters.15 The three cashew plantations covering almost 4600 hectares in Kasaragod owned by a public sector undertaking under the state government were sprayed with endosulfan aerially for 24 years (1976 to 2000) at the rate of three times a year resulting in several chronic and critical ailments in the areas nearby the cashew plantations. Global gene expression studies in Drosophila melanogaster in the past have provided insights into alterations in various biological processes.16 Endosulfan induced global changes in gene expression have still not been explained, though there are several studies based on specific markers of exposure.17

 

In this study, the expression pattern of the CYP4d2 gene in Drosophila samples collected from two different endosulfan-affected areas was analyzed. We also analyzed CYP4d2 gene expression between the larval and adult stages of Drosophila treated with different doses of endosulfan.

 

MATERIALS AND EXPERIMENTAL METHODS:

1 Samples:

Drosophila melanogaster samples were collected from two cashew plantations in Kasaragod district, where Endosulfan was highly sprayed; (Cashew Plantation Muliyar and Cashew Plantation Periya). Drosophila melanogaster (Oreogon K strain) was also cultured in the lab in culture media which includes: Agar-Agar, Rava, Jaggery, Water and Propionic acid. Three lethal doses (LD) of Endosulphan were then added to the culture medium for the experiment.  Each lethal dose (LD) of Endosulfan i.e. LD25, LD50 and LD75, added separately in 250ml of culture media, was then transferred to four identical culture bottles. Untreated Drosophila melanogaster which was cultured in the lab was used as a control for the expression analysis.

 

2 Isolation of total RNA and reverse transcription of total RNA:

Total RNA was isolated using TRIzol (Invitrogen Inc, USA) according to the manufacturers protocol. Approximately 50-100 mg of Drosophila samples were used for RNA isolation. The quality and concentration of RNA were assessed using Nanodrop Spectrophotometer and was separated on 2% agarose gel. The total RNA isolated was used for cDNA synthesis. The first strand cDNA synthesis was carried out using cDNeasy kit method (Invitrogen Inc, USA). Reverse transcriptions (RT) were performed using oligo-dT primers in a 20 μL reaction. The cDNA synthesized was stored at -20˚C for the further use of RT- PCR.

 

3 Primer design and Expression analysis of CYP4d2 gene using Real Time PCR:

A CYP4d2 gene from Cytochrome P450 family was selected for this study.

RT-PCR was carried out on a Roche -Light Cycler® 480 System using QuantiTect SYBR Green PCR Kit (Qiagen Inc). Each PCR reaction was set up in a 96-well PCR plate in a total volume of 20 μL using 0.1 μg (10 fold dilution) of first-strand cDNA and CYP4d2 gene primer. (Table.1). Triplicates of cDNA amplification were performed to check for consistency between readings. Comparative -ΔΔCt method was used for detecting the expression level of a CYP4d2 gene using Beta-Actin as the reference gene for data normalization. Untreated Drosophila melanogaster cultured in the lab was used as a control and Beta- Actin (Gene ID: 60) as the reference gene for the expression analysis.

 

Primer for CYP4d2 gene was designed with following conditions:

 

Table 1: Primer for CYP4d2 gene

Oligo
 
Length
 
Tm
 
GC%
 
Sequence

Product Size

 
Left primer
 
25
 
59.94
 
40.00
 
TATGGAGAACGTAATTAAGGAGTCG

149bp

 
Right primer
 
24
 
61.46
 
41.67
 
TATGGAGAACGTAATTAAGGAGTCG

 

Primer Sequence for Reference gene Beta-Actin:

Table 2: Primer for Beta-Actin gene.

Gene-Symbol

Forward primer

Reverse primer

Reference

ACTB

CTGGAACGGTGAAGGTGACA

AAGGGACTTCCTGTAACAATGCA

21

 

 

RESULT AND DISCUSSION:

To investigate expression of Cyp4d2 differ following endosulphan selection, the expression level of Cyp4d2 gene was compared with Drosophila samples collected from two different endosulphan affected areas (Muliyar and Periya) and in both larvae and adults treated with different doses of endosulphan using qRT-PCR.

 

From the analysis of gene expression of the samples (Table 3) from the two endosulfan endemic areas; the expression value for the samples from Muliyar was found to be 0.5 whereas in samples from periya it was found to be 16 which are higher than the value compared to Muliyar. Variation in the expression level of CYP4d2 gene among the two Drosophila populations from the graph 1 indicates that in different populations, different sets of detoxifying genes are involved in mediating insecticide resistance.18

 

Table 3: CYP 4d2 gene expression in D. melanogaster collected from two endosulfan endemic area and artificially treated D. melanogaster.

Locations/Doses

Gene Expression Value (2ˉΔΔCT)

Location 1

Location 2

Muliyar

0.5

Periya

16

Lethal Doses:

Larvae

Lab Culture

LD25

0.0078

LD50

0.031

LD75

0.005

Lethal Doses:

Adults

Lab Culture

LD25

2

LD50

12.9

LD75

1.5

 

Hypothetically, insecticide resistance can be due to the heightened expression of detoxification enzymes capable of metabolizing these chemicals.5 The down regulation of P450 gene in insect could be associated with the homeostatic response that defends the cell from the harmful effect of extra oxidizing species and metabolites derived from the up regulated CYP450s (18).

 

Among the two stages (larval stage and adult stage) of Drosophila treated with different concentrations of endosulfan; the gene expression value was found to be higher in the adult stage (2, 12.9 and 1.5) in comparison to larval stage (0.007, 0.031 and 0.005). It has been reported in Culex quinquefasciatus that P450 genes were developmentally regulated following insecticide selection. Up regulation of CYP4d2 gene in the adult suggests that different P450 genes are affected due to insecticide pressure in different developmental stages.¹9 The expression of CYP gene in insects can be influenced by the concentration of the insecticides and also the exposure times. Several studies have revealed that comparatively low sub lethal concentration and short period of insecticide exposure were found to be effective for the up regulation of CYP genes than higher concentration and longer exposure duration.²0 From the Fig. 2 and 3, it was understood that both adults and larvae showed an up regulation of CYP4d2 gene at concentration LD50 than at LD75. The higher concentration can lead to augmented toxic stress to insects.

 

Figure 1: Showing gene expression profiling of gene CYP4d2 in D. melanogaster from the two endosulfan endemic areas; Muliyar and Periya respectively.

 

 

Figure 2: Showing gene expression profiling of gene CYP4d2 from larval stage of D. melanogaster cultured in lab and treated with three lethal doses of endosulfan (LD25, LD50, and LD75) in compared to control population.

 

 

 

Figure 3: Showing gene expression profiling of gene CYP4d2 from adult stage of D. melanogaster cultured in lab and treated with three lethal doses of endosulfan (LD 25, LD 50, and LD 75) in compared to control population.

 

 

Figure 4: Graph showing amplification curves of gene CYP4d2 in D. melanogaster from Periya location.     

 

Figure 5: Graph showing amplification curves of CYP4d2 gene of adult stage in D. melanogaster treated with endosulfan in lab culture.

 

 

 

 

CONCLUSION:

The study was carried out to analyze the effect of insecticide endosulfan, on the expression of CYP4d2 gene in Drosophila melanogaster to detect if it has any role in endosulfan detoxification.  The Drosophila population collected from Periya showed an up regulation of the CYP4d2 gene when compared to Muliyar. The adult samples showed higher expression of the CYP gene than larvae. It is understood that several detoxifying genes are involved in insecticide resistance in different populations and different developmental stages. Both up regulation and down regulation of CYP genes are equally important for insecticide selection and detoxification and also in homeostatic response of insects to the varying cell environment.

 

ACKNOWLEDGEMENT:

The authors are grateful to the authorities of Department of Genomic Sciences, Central University of Kerala Kasaragod for the facilities.

 

CONFLICT OF INTEREST:

The authors declare no conflict of interest.

 

REFERENCES:

1.        Flint, Mary Louise. Pests of the garden and small farm: a grower's guide to using less pesticide. Vol. 3332. Univ of California Press, 1998.

2.        Hill, Dennis S. Agricultural insect pests of the tropics and their control. CUP Archive, 1983.

3.        Edwards, C. A., ed. Environmental pollution by pesticides. Vol. 3. Springer Science and Business Media, 2013.

4.        Aktar, Wasim, Dwaipayan Sengupta, and Ashim Chowdhury. "Impact of pesticides use in agriculture: their benefits and hazards." Interdisciplinary toxicology 2.1 (2009): 1-12.

5.        Frederic Faucon, Isabelle Dusfour, Thierry Gaude, Vincent Navratil, Frederic Boyer, Fabrice Chandre, Patcharawan Sirisopa, Kanutcharee Thanispong, Waraporn Juntarajumnong, Rodolphe Poupardin, Theeraphap Chareonviriyaphap, Romain Girod, Vincent Corbel, Stephane Reynaud and Jean-Philippe David, "Identifying genomic changes associated with insecticide resistance in the dengue mosquito Aedesaegypti by deep targeted sequencing." Genome research 25.9 (2015): 1347-1359.

6.        Daborn, Phillip J., Christopher Lumb, Thomas W.R. Harrop, Alex Blasetti, Shivani Pasricha, Shai Morin, Sara N. Mitchell, Martin J. Donnelly, Pie Müller, Philip Batterham, "Using Drosophila melanogaster to validate metabolism-based insecticide resistance from insect pests." Insect biochemistry and molecular biology 42.12 (2012): 918-924.

7.        Takahiro, Miyo. "The genetic architecture of insecticide resistance within a natural population of Drosophila melanogaster." Open Journal of Genetics2012 (2012).

8.        Maeva Giraudo, G. Chandran Unnithan, Gaëlle Le Goff, René Feyereisen, "Regulation of cytochrome P450 expression in Drosophila: Genomic insights." Pesticide biochemistry and physiology 97.2 (2010): 115-122

9.        Daborn, P. J, J. L. Yen, M. R. Bogwitz, G. Le Goff, E. Feil, S. Jeffers, N. Tijet, T. Perry, D. Heckel, P. Batterham, R. Feyereisen, T. G. Wilson, R. H. ffrench-Constant, "A single P450 allele associated with insecticide resistance in Drosophila." Science 297.5590 (2002): 2253-2256.

10.      Mc Cart, Caroline. "Dissecting the insecticide‐resistance‐associated cytochrome P450 gene Cyp6g1." Pest management science 64.6 (2008): 639-645.

11.      Daborn, Phillip J., and Gaelle Le Goff. "The genetics and genomics of insecticide resistance." TRENDS in Genetics 20.3 (2004): 163-170.

12.      Chung, Hock Wee Henry. "Cytochrome P450 gene expression in Drosophila melanogaster." (2008).

13.      Abhilash, P. C., and Nandita Singh. "Pesticide use and application: an Indian scenario." Journal of hazardous materials 165.1 (2009): 1-12.

14.      Jan Weber, Crispin J. Halsall, Derek Muir, Camilla Teixeira, Jeff Small, Keith Solomon, Mark Hermanson, Hayley Hung, Terry Bidlemanf "Endosulfan, a global pesticide: a review of its fate in the environment and occurrence in the Arctic." Science of the Total Environment408.15 (2010): 2966-2984.

15.      Quijano, Romeo F. "Endosulfan Poisoning in Kasargod, Kerala, India." (2002).

16.      Kirst King-Jones, Michael A. Horner, Geanette Lam, Carl S. Thummel, "The DHR96 nuclear receptor regulates xenobiotic responses in Drosophila." Cell Metabolism 4.1 (2006): 37-48.

17.      Anurag Sharma, M. Mishra, K. Ravi Ram, R. Kumar,M.Z. Abdin, D. Kar Chowdhuri, "Transcriptome analysis provides insights for understanding the adverse effects of endosulfan in Drosophila melanogaster." Chemosphere 82.3 (2011): 370-376.

18.      Yang, Ting, and Nannan Liu. "Genome analysis of cytochrome P450s and their expression profiles in insecticide resistant mosquitoes, Culex quinquefasciatus." PLoS One 6.12 (2011): e29418.

19.      Ting Li and Nannan Liu. "Inheritance of permethrin resistance in Culex quinquefasciatus." Journal of medical entomology 47.6 (2010): 1127-1134.

20.      Xiao Liang, Da Xiao, Yanping He, Jianxiu Yao, Guonian Zhu and Kun Yan Zhu,"Insecticide-mediated up-regulation of cytochrome P450 genes in the red flour beetle (Triboliumcastaneum)." International journal of molecular sciences 16.1 (2015): 2078-2098.

21.      Vandesompele, Jo, Katleen De Preter, Filip Pattyn, Bruce Poppe, Nadine Van Roy, Anne De Paepe, and Frank Speleman. "Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes." Genome biology 3, no. 7 (2002): research0034-1.

 

 

 

 

 

 

Received on 13.12.2018           Modified on 21.02.2019

Accepted on 25.03.2019         © RJPT All right reserved

Research J. Pharm. and Tech. 2019; 12(11):5315-5319.

DOI: 10.5958/0974-360X.2019.00921.1